14
Dec
2009
admin

Primate Data


begin data;
[!Primate mtDNA data from: Hayasaka, K., T. Gojobori, and
S. Horai. 1988.  Molecular phylogeny and evolution of primate
mitochondrial DNA.  Mol. Biol. Evol., 5:626-644.]
dimensions ntax=12 nchar=898;	
format datatype=dna interleave gap=-;    
matrix
Homo_sapiens        AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCT
Pan                 AAGCTTCACCGGCGCAATTATCCTCATAATCGCCCACGGACTTACATCCT
Gorilla             AAGCTTCACCGGCGCAGTTGTTCTTATAATTGCCCACGGACTTACATCAT
Pongo               AAGCTTCACCGGCGCAACCACCCTCATGATTGCCCATGGACTCACATCCT
Hylobates           AAGCTTTACAGGTGCAACCGTCCTCATAATCGCCCACGGACTAACCTCTT
Macaca_fuscata      AAGCTTTTCCGGCGCAACCATCCTTATGATCGCTCACGGACTCACCTCTT
M._mulatta          AAGCTTTTCTGGCGCAACCATCCTCATGATTGCTCACGGACTCACCTCTT
M._fascicularis     AAGCTTCTCCGGCGCAACCACCCTTATAATCGCCCACGGGCTCACCTCTT
M._sylvanus         AAGCTTCTCCGGTGCAACTATCCTTATAGTTGCCCATGGACTCACCTCTT
Saimiri_sciureus    AAGCTTCACCGGCGCAATGATCCTAATAATCGCTCACGGGTTTACTTCGT
Tarsius_syrichta    AAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACCTCCT
Lemur_catta         AAGCTTCATAGGAGCAACCATTCTAATAATCGCACATGGCCTTACATCAT
Homo_sapiens        CATTACTATTCTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGC
Pan                 CATTATTATTCTGCCTAGCAAACTCAAATTATGAACGCACCCACAGTCGC
Gorilla             CATTATTATTCTGCCTAGCAAACTCAAACTACGAACGAACCCACAGCCGC
Pongo               CCCTACTGTTCTGCCTAGCAAACTCAAACTACGAACGAACCCACAGCCGC
Hylobates           CCCTGCTATTCTGCCTTGCAAACTCAAACTACGAACGAACTCACAGCCGC
Macaca_fuscata      CCATATATTTCTGCCTAGCCAATTCAAACTATGAACGCACTCACAACCGT
M._mulatta          CCATATATTTCTGCCTAGCCAATTCAAACTATGAACGCACTCACAACCGT
M._fascicularis     CCATGTATTTCTGCTTGGCCAATTCAAACTATGAGCGCACTCATAACCGT
M._sylvanus         CCATATACTTCTGCTTGGCCAACTCAAACTACGAACGCACCCACAGCCGC
Saimiri_sciureus    CTATGCTATTCTGCCTAGCAAACTCAAATTACGAACGAATTCACAGCCGA
Tarsius_syrichta    CCCTATTATTTTGCCTAGCAAATACAAACTACGAACGAGTCCACAGTCGA
Lemur_catta         CCATATTATTCTGTCTAGCCAACTCTAACTACGAACGAATCCATAGCCGT
Homo_sapiens        ATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTT
Pan                 ATCATAATTCTCTCCCAAGGACTTCAAACTCTACTCCCACTAATAGCCTT
Gorilla             ATCATAATTCTCTCTCAAGGACTCCAAACCCTACTCCCACTAATAGCCCT
Pongo               ATCATAATCCTCTCTCAAGGCCTTCAAACTCTACTCCCCCTAATAGCCCT
Hylobates           ATCATAATCCTATCTCGAGGGCTCCAAGCCTTACTCCCACTGATAGCCTT
Macaca_fuscata      ACCATACTACTGTCCCGAGGACTTCAAATCCTACTTCCACTAACAGCCTT
M._mulatta          ACCATACTACTGTCCCGGGGACTTCAAATCCTACTTCCACTAACAGCTTT
M._fascicularis     ACCATACTACTATCCCGAGGACTTCAAATTCTACTTCCATTGACAGCCTT
M._sylvanus         ATCATACTACTATCCCGAGGACTCCAAATCCTACTCCCACTAACAGCCTT
Saimiri_sciureus    ACAATAACATTTACTCGAGGGCTCCAAACACTATTCCCGCTTATAGGCCT
Tarsius_syrichta    ACAATAGCACTAGCCCGTGGCCTTCAAACCCTATTACCTCTTGCAGCAAC
Lemur_catta         ACAATACTACTAGCACGAGGGATCCAAACCATTCTCCCTCTTATAGCCAC
Homo_sapiens        TTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTA
Pan                 TTGATGACTCCTAGCAAGCCTCGCTAACCTCGCCCTACCCCCTACCATTA
Gorilla             TTGATGACTTCTGGCAAGCCTCGCCAACCTCGCCTTACCCCCCACCATTA
Pongo               CTGATGACTTCTAGCAAGCCTCACTAACCTTGCCCTACCACCCACCATCA
Hylobates           CTGATGACTCGCAGCAAGCCTCGCTAACCTCGCCCTACCCCCCACTATTA
Macaca_fuscata      TTGATGATTAACAGCAAGCCTTACTAACCTTGCCCTACCCCCCACTATCA
M._mulatta          CTGATGATTAACAGCAAGCCTTACTAACCTTGCCCTACCCCCCACTATCA
M._fascicularis     CTGATGACTCACAGCAAGCCTTACTAACCTTGCCCTACCCCCCACTATTA
M._sylvanus         CTGATGATTCACAGCAAGCCTTACTAATCTTGCTCTACCCTCCACTATTA
Saimiri_sciureus    CTGATGACTCCTAGCAAATCTCGCTAACCTCGCCCTACCCACAGCTATTA
Tarsius_syrichta    ATGATGACTCCTCGCCAGCTTAACCAACCTGGCCCTTCCCCCAACAATTA
Lemur_catta         CTGATGACTACTCGCCAGCCTAACTAACCTAGCCCTACCCACCTCTATCA
Homo_sapiens        ACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAAT
Pan                 ATCTCCTAGGGGAACTCTCCGTGCTAGTAACCTCATTCTCCTGATCAAAT
Gorilla             ACCTACTAGGAGAGCTCTCCGTACTAGTAACCACATTCTCCTGATCAAAC
Pongo               ACCTTCTAGGAGAACTCTCCGTACTAATAGCCATATTCTCTTGATCTAAC
Hylobates           ACCTCCTAGGTGAACTCTTCGTACTAATGGCCTCCTTCTCCTGGGCAAAC
Macaca_fuscata      ATCTACTAGGTGAACTCTTTGTAATCGCAACCTCATTCTCCTGATCCCAT
M._mulatta          ACCTACTAGGTGAACTCTTTGTAATCGCGACCTCATTCTCCTGGTCCCAT
M._fascicularis     ATCTACTAGGCGAACTCTTTGTAATCACAACTTCATTTTCCTGATCCCAT
M._sylvanus         ATCTACTGGGCGAACTCTTCGTAATCGCAACCTCATTTTCCTGATCCCAC
Saimiri_sciureus    ATCTAGTAGGAGAATTACTCACAATCGTATCTTCCTTCTCTTGATCCAAC
Tarsius_syrichta    ATTTAATCGGTGAACTGTCCGTAATAATAGCAGCATTTTCATGGTCACAC
Lemur_catta         ATTTAATTGGCGAACTATTCGTCACTATAGCATCCTTCTCATGATCAAAC
Homo_sapiens        ATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTC
Pan                 ACCACTCTCCTACTCACAGGATTCAACATACTAATCACAGCCCTGTACTC
Gorilla             ACCACCCTTTTACTTACAGGATCTAACATACTAATTACAGCCCTGTACTC
Pongo               ATCACCATCCTACTAACAGGACTCAACATACTAATCACAACCCTATACTC
Hylobates           ACTACTATTACACTCACCGGGCTCAACGTACTAATCACGGCCCTATACTC
Macaca_fuscata      ATCACCATTATGCTAACAGGACTTAACATATTAATTACGGCCCTCTACTC
M._mulatta          ATCACCATTATATTAACAGGATTTAACATACTAATTACGGCCCTCTACTC
M._fascicularis     ATCACCATTGTGTTAACGGGCCTTAATATACTAATCACAGCCCTCTACTC
M._sylvanus         ATCACCATCATACTAACAGGACTGAACATACTAATTACAGCCCTCTACTC
Saimiri_sciureus    TTTACTATTATATTCACAGGACTTAATATACTAATTACAGCACTCTACTC
Tarsius_syrichta    CTAACTATTATCTTAGTAGGCCTTAACACCCTTATCACCGCCCTATATTC
Lemur_catta         ATTACAATTATCTTAATAGGCTTAAATATGCTCATCACCGCTCTCTATTC
Homo_sapiens        CCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTA
Pan                 CCTCTACATGTTTACCACAACACAATGAGGCTCACTCACCCACCACATTA
Gorilla             CCTTTATATATTTACCACAACACAATGAGGCCCACTCACACACCACATCA
Pongo               TCTCTATATATTCACCACAACACAACGAGGTACACCCACACACCACATCA
Hylobates           CCTTTACATATTTATCATAACACAACGAGGCACACTTACACACCACATTA
Macaca_fuscata      TCTCCACATATTCACTACAACACAACGAGGAACACTCACACATCACATAA
M._mulatta          CCTCCACATATTCACCACAACACAACGAGGAGCACTCACACATCACATAA
M._fascicularis     TCTCCACATGTTCATTACAGTACAACGAGGAACACTCACACACCACATAA
M._sylvanus         TCTTCACATATTCACCACAACACAACGAGGAGCGCTCACACACCACATAA
Saimiri_sciureus    ACTTCATATGTATGCCTCTACACAGCGAGGTCCACTTACATACAGCACCA
Tarsius_syrichta    CCTATATATACTAATCATAACTCAACGAGGAAAATACACATATCATATCA
Lemur_catta         CCTCTATATATTAACTACTACACAACGAGGAAAACTCACATATCATTCGC
Homo_sapiens        ACAACATAAAACCCTCATTCACACGAGAAAACACCCTCATGTTCATACAC
Pan                 ATAACATAAAGCCCTCATTCACACGAGAAAATACTCTCATATTTTTACAC
Gorilla             CCAACATAAAACCCTCATTTACACGAGAAAACATCCTCATATTCATGCAC
Pongo               ACAACATAAAACCTTCTTTCACACGCGAAAATACCCTCATGCTCATACAC
Hylobates           AAAACATAAAACCCTCACTCACACGAGAAAACATATTAATACTTATGCAC
Macaca_fuscata      TCAACATAAAGCCCCCCTTCACACGAGAAAACACATTAATATTCATACAC
M._mulatta          TCAACATAAAACCCCCCTTCACACGAGAAAACATATTAATATTCATACAC
M._fascicularis     TCAATATAAAACCCCCCTTCACACGAGAAAACATATTAATATTCATACAC
M._sylvanus         TTAACATAAAACCACCTTTCACACGAGAAAACATATTAATACTCATACAC
Saimiri_sciureus    GCAATATAAAACCAATATTTACACGAGAAAATACGCTAATATTTATACAT
Tarsius_syrichta    ACAATATCATGCCCCCTTTCACCCGAGAAAATACATTAATAATCATACAC
Lemur_catta         ACAACCTAAACCCATCCTTTACACGAGAAAACACCCTTATATCCATACAC
Homo_sapiens        CTATCCCCCATTCTCCTCCTATCCCTCAACCCCGACATCATTACCGGGTT
Pan                 CTATCCCCCATCCTCCTTCTATCCCTCAATCCTGATATCATCACTGGATT
Gorilla             CTATCCCCCATCCTCCTCCTATCCCTCAACCCCGATATTATCACCGGGTT
Pongo               CTATCCCCCATCCTCCTCTTATCCCTCAACCCCAGCATCATCGCTGGGTT
Hylobates           CTCTTCCCCCTCCTCCTCCTAACCCTCAACCCTAACATCATTACTGGCTT
Macaca_fuscata      CTCGCTCCAATTATCCTTCTATCCCTCAACCCCAACATCATCCTGGGGTT
M._mulatta          CTCGCTCCAATCATCCTCCTATCTCTCAACCCCAACATCATCCTGGGGTT
M._fascicularis     CTCGCTCCAATTATCCTTCTATCTCTCAACCCCAACATCATCCTGGGGTT
M._sylvanus         CTCGCTCCAATTATTCTTCTATCTCTTAACCCCAACATCATTCTAGGATT
Saimiri_sciureus    ATAACACCAATCCTCCTCCTTACCTTGAGCCCCAAGGTAATTATAGGACC
Tarsius_syrichta    CTATTTCCCTTAATCCTACTATCTACCAACCCCAAAGTAATTATAGGAAC
Lemur_catta         ATACTCCCCCTTCTCCTATTTACCTTAAACCCCAAAATTATTCTAGGACC
Homo_sapiens        TTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACA
Pan                 CACCTCCTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACA
Gorilla             CACCTCCTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGATA
Pongo               CGCCTACTGTAAATATAGTTTAACCAAAACATTAGATTGTGAATCTAATA
Hylobates           TACTCCCTGTAAACATAGTTTAATCAAAACATTAGATTGTGAATCTAACA
Macaca_fuscata      TACCTCCTGTAGATATAGTTTAACTAAAACACTAGATTGTGAATCTAACC
M._mulatta          TACTTCCTGTAGATATAGTTTAACTAAAACATTAGATTGTGAATCTAACC
M._fascicularis     TACCTCCTGTAAATATAGTTTAACTAAAACATTAGATTGTGAATCTAACT
M._sylvanus         TACTTCCTGTAAATATAGTTTAATTAAAACATTAGACTGTGAATCTAACT
Saimiri_sciureus    CTCACCTTGTAATTATAGTTTAGCTAAAACATTAGATTGTGAATCTAATA
Tarsius_syrichta    CATGTACTGTAAATATAGTTTAAACAAAACATTAGATTGTGAGTCTAATA
Lemur_catta         CACGTACTGTAAATATAGTTTAAA-AAAACACTAGATTGTGAATCCAGAA
Homo_sapiens        ACAGAGGCTTA-CGACCCCTTATTTACCGAGAAAGCT-CACAAGAACTGC
Pan                 ACAGAGGCTCA-CGACCCCTTATTTACCGAGAAAGCT-TATAAGAACTGC
Gorilla             ACAGAGGCTCA-CAACCCCTTATTTACCGAGAAAGCT-CGTAAGAGCTGC
Pongo               ATAGGGCCCCA-CAACCCCTTATTTACCGAGAAAGCT-CACAAGAACTGC
Hylobates           ATAGAGGCTCG-AAACCTCTTGCTTACCGAGAAAGCC-CACAAGAACTGC
Macaca_fuscata      ATAGAGACTCA-CCACCTCTTATTTACCGAGAAAACT-CGCAAGGACTGC
M._mulatta          ATAGAGACTTA-CCACCTCTTATTTACCGAGAAAACT-CGCGAGGACTGC
M._fascicularis     ATAGAGGCCTA-CCACTTCTTATTTACCGAGAAAACT-CGCAAGGACTGC
M._sylvanus         ATAGAAGCTTA-CCACTTCTTATTTACCGAGAAAACT-TGCAAGGACCGC
Saimiri_sciureus    ATAGAAGAATA-TAACTTCTTAATTACCGAGAAAGTG-CGCAAGAACTGC
Tarsius_syrichta    ATAGAAGCCCAAAGATTTCTTATTTACCAAGAAAGTA-TGCAAGAACTGC
Lemur_catta         ATAGAAGCTCAAAC-CTTCTTATTTACCGAGAAAGTAATGTATGAACTGC
Homo_sapiens        TAACTCATGCCCCCATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGA
Pan                 TAATTCATATCCCCATGCCTGACAACATGGCTTTCTCAACTTTTAAAGGA
Gorilla             TAACTCATACCCCCGTGCTTGACAACATGGCTTTCTCAACTTTTAAAGGA
Pongo               TAACTCTCACT-CCATGTGTGACAACATGGCTTTCTCAGCTTTTAAAGGA
Hylobates           TAACTCACTATCCCATGTATGACAACATGGCTTTCTCAACTTTTAAAGGA
Macaca_fuscata      TAACCCATGTACCCGTACCTAAAATTACGGTTTTCTCAACTTTTAAAGGA
M._mulatta          TAACCCATGTATCCGTACCTAAAATTACGGTTTTCTCAACTTTTAAAGGA
M._fascicularis     TAATCCATGCCTCCGTACTTAAAACTACGGTTTCCTCAACTTTTAAAGGA
M._sylvanus         TAATCCACACCTCCGTACTTAAAACTACGGTTTTCTCAACTTTTAAAGGA
Saimiri_sciureus    TAATTCATGCTCCCAAGACTAACAACTTGGCTTCCTCAACTTTTAAAGGA
Tarsius_syrichta    TAACTCATGCCTCCATATATAACAATGTGGCTTTCTT-ACTTTTAAAGGA
Lemur_catta         TAACTCTGCACTCCGTATATAAAAATACGGCTATCTCAACTTTTAAAGGA
Homo_sapiens        TAACAGCTATCCATTGGTCTTAGGCCCCAAAAATTTTGGTGCAACTCCAA
Pan                 TAACAGCCATCCGTTGGTCTTAGGCCCCAAAAATTTTGGTGCAACTCCAA
Gorilla             TAACAGCTATCCATTGGTCTTAGGACCCAAAAATTTTGGTGCAACTCCAA
Pongo               TAACAGCTATCCCTTGGTCTTAGGATCCAAAAATTTTGGTGCAACTCCAA
Hylobates           TAACAGCTATCCATTGGTCTTAGGACCCAAAAATTTTGGTGCAACTCCAA
Macaca_fuscata      TAACAGCTATCCATTGACCTTAGGAGTCAAAAACATTGGTGCAACTCCAA
M._mulatta          TAACAGCTATCCATTGACCTTAGGAGTCAAAAATATTGGTGCAACTCCAA
M._fascicularis     TAACAGCTATCCATTGACCTTAGGAGTCAAAAACATTGGTGCAACTCCAA
M._sylvanus         TAACAGCTATCCATTGGCCTTAGGAGTCAAAAATATTGGTGCAACTCCAA
Saimiri_sciureus    TAGTAGTTATCCATTGGTCTTAGGAGCCAAAAACATTGGTGCAACTCCAA
Tarsius_syrichta    TAGAAGTAATCCATCGGTCTTAGGAACCGAAAA-ATTGGTGCAACTCCAA
Lemur_catta         TAGAAGTAATCCATTGGCCTTAGGAGCCAAAAA-ATTGGTGCAACTCCAA
Homo_sapiens        ATAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTGACTTC
Pan                 ATAAAAGTAATAACCATGTATACTACCATAACCACCTTAACCCTAACTCC
Gorilla             ATAAAAGTAATAACTATGTACGCTACCATAACCACCTTAGCCCTAACTTC
Pongo               ATAAAAGTAACAGCCATGTTTACCACCATAACTGCCCTCACCTTAACTTC
Hylobates           ATAAAAGTAATAGCAATGTACACCACCATAGCCATTCTAACGCTAACCTC
Macaca_fuscata      ATAAAAGTAATAATCATGCACACCCCCATCATTATAACAACCCTTATCTC
M._mulatta          ATAAAAGTAATAATCATGCACACCCCTATCATAATAACAACCCTTATCTC
M._fascicularis     ATAAAAGTAATAATCATGCACACCCCCATCATAATAACAACCCTCATCTC
M._sylvanus         ATAAAAGTAATAATCATGTATACCCCCATCATAATAACAACTCTCATCTC
Saimiri_sciureus    ATAAAAGTAATA---ATACACTTCTCCATCACTCTAATAACACTAATTAG
Tarsius_syrichta    ATAAAAGTAATAAATTTATTTTCATCCTCCATTTTACTATCACTTACACT
Lemur_catta         ATAAAAGTAATAAATCTATTATCCTCTTTCACCCTTGTCACACTGATTAT
Homo_sapiens        CCTAATTCCCCCCATCCTTACCACCCTCGTTAACCCTAACAAAAAAAACT
Pan                 CTTAATTCTCCCCATCCTCACCACCCTCATTAACCCTAACAAAAAAAACT
Gorilla             CTTAATTCCCCCTATCCTTACCACCTTCATCAATCCTAACAAAAAAAGCT
Pongo               CCTAATCCCCCCCATTACCGCTACCCTCATTAACCCCAACAAAAAAAACC
Hylobates           CCTAATTCCCCCCATTACAGCCACCCTTATTAACCCCAATAAAAAGAACT
Macaca_fuscata      CCTAACTCTCCCAATTTTTGCCACCCTCATCAACCCTTACAAAAAACGTC
M._mulatta          CCTAACTCTCCCAATTTTTGCCACCCTCATCAACCCTTACAAAAAACGTC
M._fascicularis     CCTGACCCTTCCAATTTTTGCCACCCTCACCAACCCCTATAAAAAACGTT
M._sylvanus         CCTAACTCTTCCAATTTTCGCTACCCTTATCAACCCCAACAAAAAACACC
Saimiri_sciureus    CCTACTAGCGCCAATCCTAGCTACCCTCATTAACCCTAACAAAAGCACAC
Tarsius_syrichta    CTTAATTACCCCATTTATTATTACAACAACTAAAAAATATGAAACACATG
Lemur_catta         CCTAACTTTACCTATCATTATAAACGTTACAAACATATACAAAAACTACC
Homo_sapiens        CATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTATTATCAGT
Pan                 CATATCCCCATTATGTGAAATCCATTATCGCGTCCACCTTTATCATTAGC
Gorilla             CATACCCCCATTACGTAAAATCTATCGTCGCATCCACCTTTATCATCAGC
Pongo               CATACCCCCACTATGTAAAAACGGCCATCGCATCCGCCTTTACTATCAGC
Hylobates           TATACCCGCACTACGTAAAAATGACCATTGCCTCTACCTTTATAATCAGC
Macaca_fuscata      CATACCCAGATTACGTAAAAACAACCGTAATATATGCTTTCATCATCAGC
M._mulatta          CATACCCAGATTACGTAAAAACAACCGTAATATATGCTTTCATCATCAGC
M._fascicularis     CATACCCAGACTACGTAAAAACAACCGTAATATATGCTTTTATTACCAGT
M._sylvanus         TATATCCAAACTACGTAAAAACAGCCGTAATATATGCTTTCATTACCAGC
Saimiri_sciureus    TATACCCGTACTACGTAAAACTAGCCATCATCTACGCCCTCATTACCAGT
Tarsius_syrichta    CATACCCTTACTACGTAAAAAACTCTATCGCCTGCGCATTTATAACAAGC
Lemur_catta         CCTATGCACCATACGTAAAATCTTCTATTGCATGTGCCTTCATCACTAGC
Homo_sapiens        CTCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTC
Pan                 CTTTTCCCCACAACAATATTCATATGCCTAGACCAAGAAGCTATTATCTC
Gorilla             CTCTTCCCCACAACAATATTTCTATGCCTAGACCAAGAAGCTATTATCTC
Pongo               CTTATCCCAACAACAATATTTATCTGCCTAGGACAAGAAACCATCGTCAC
Hylobates           CTATTTCCCACAATAATATTCATGTGCACAGACCAAGAAACCATTATTTC
Macaca_fuscata      CTCCCCTCAACAACTTTATTCATCTTCTCAAACCAAGAAACAACCATTTG
M._mulatta          CTCCCCTCAACAACTTTATTCATCTTCTCAAACCAAGAAACAACCATTTG
M._fascicularis     CTCCCCTCAACAACCCTATTCATCCTCTCAAACCAAGAAACAACCATTTG
M._sylvanus         CTCTCTTCAACAACTTTATATATATTCTTAAACCAAGAAACAATCATCTG
Saimiri_sciureus    ACCTTATCTATAATATTCTTTATCCTTACAGGCCAAGAATCAATAATTTC
Tarsius_syrichta    CTAGTCCCAATGCTCATATTTCTATACACAAATCAAGAAATAATCATTTC
Lemur_catta         CTCATCCCAACTATATTATTTATCTCCTCAGGACAAGAAACAATCATTTC
Homo_sapiens        GAACTGACACTGAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTT
Pan                 AAACTGGCACTGAGCAACAACCCAAACAACCCAGCTCTCCCTAAGCTT
Gorilla             AAGCTGACACTGAGCAACAACCCAAACAATTCAACTCTCCCTAAGCTT
Pongo               AAACTGATGCTGAACAACCACCCAGACACTACAACTCTCACTAAGCTT
Hylobates           AAACTGACACTGAACTGCAACCCAAACGCTAGAACTCTCCCTAAGCTT
Macaca_fuscata      GAGCTGACATTGAATAATGACCCAAACACTAGACCTAACGCTAAGCTT
M._mulatta          AAGCTGACATTGAATAATAACCCAAACACTAGACCTAACACTAAGCTT
M._fascicularis     GAGTTGACATTGAATAACAACCCAAACATTAGACCTAACACTAAGCTT
M._sylvanus         AAGCTGGCACTGAATAATAACCCAAACACTAAGCCTAACATTAAGCTT
Saimiri_sciureus    AAACTGACACTGAATAACTATCCAAACCATCAAACTATCCCTAAGCTT
Tarsius_syrichta    CAACTGACATTGAATAACGATTCATACTATCAAATTATGCCTAAGCTT
Lemur_catta         CAACTGACATTGAATAACAATCCAAACCCTAAAACTATCTATTAGCTT    
;
end;
begin assumptions;    
usertype ttbias2 
stepmatrix = 4
    A C G T       
[A] . 2 1 2       
[C] 2 . 2 1  
[G] 1 2 . 2       
[T] 2 1 2 . ;     
usertype ttbias6 
stepmatrix = 4           
    A C G T       
[A] . 6 1 6       
[C] 6 . 6 1       
[G] 1 6 . 6       
[T] 6 1 6 . ;      
usertype tvonly 
stepmatrix = 4           
    A C G T       
[A] . 1 0 1       
[C] 1 . 1 0       
[G] 0 1 . 1       
[T] 1 0 1 . ;   
charset tRNA_His = 459-528;    
charset 'tRNA_Ser_(AGY)' = 529-588;    
charset 'tRNA_Leu_(CUN)' = 589-659;    
charset 1st_positions = 2-455\3 660-894\3;    
charset 2nd_positions = 3-456\3 661-895\3;    
charset 3rd_positions = 4-457\3 662-896\3;    
exset  protein_only = 1 458-659 897 898;    
exset  non_protein = 2-457 660-896;
end;
begin codons;    
codonposset * codons = N: 1 458-659 897 898, 1: 2-455\3 660-894\3, 
2: 3-456\3 661-895\3, 3: 4-457\3 662-896\3;
;[temp]codeset * codeset = mtDNA.mam.ext: all;
end;
begin sets;    
charset Non = 1 458-659 897 898;     
charset 1st = 2-455\3 660-894\3;     
charset 2nd = 3-456\3 661-895\3;     
charset 3rd = 4-457\3 662-896\3;	
charpartition *a = n3:Non 3rd, 1:1st, 2:2nd;